Mad Max Fury Road (2015)

Genero: Accion – Thriller Pais: USA Duracion 120 minutos Director: George Miller Guion: Nick Lathouris, Brendan McCarthy, George Miller Reparto: Tom Hardy, Charlize Theron, Nicholas Hoult, Hugh Keays-Byrne, Angus Sampson, Zoë Kravitz, Rosie Huntington-Whiteley, Nathan Jones, Riley Keough, Abbey Lee, Courtney Eaton, Josh Helman, Megan Gale, Melissa Jaffer, Stephen Dunlevy

Mad Max Furia en la carretera 2015

RESEÑA: Perseguido por su turbulento pasado, Mad Max cree que la mejor forma de sobrevivir es ir solo por el mundo. Sin embargo, se ve arrastrado a formar parte de un grupo que huye a través del desierto en un War Rig conducido por una Emperatriz de élite: Furiosa. Escapan de una Ciudadela tiranizada por Immortan Joe, a quien han arrebatado algo irreemplazable. Enfurecido, el Señor de la Guerra moviliza a todas sus bandas y persigue implacablemente a los rebeldes en una Furia en la Cerretera de altas revoluciones… Cuarta entrega de la saga post-apocalíptica que resucita George Miller.


Calidad: HD720
Audio: Ingles
pelicula Mad Max Fury Road
pelicula mad max fury road


Mad Max peliculaMad Max Fury Road peliculaMad Max Fury Road 2015  Mad Max Fury Road 2015

  • Nova


  • fanny

    Descargando sin más……………………
    Gracias por el aporte

  • Espi

    Al lio ke esta promete!! Gracias Mono!!!!

    • fanny

      No he oído a nadie que la haya visto que hable mal de ella.
      Un abrazo Espi

      • Yo si te puedo decir que es impresionante. Fui al cine con mil dudas y la verdad que es un espectáculo con letras mayusculas.

      • Espi

        La acabo de ver y es un trallazo!!! Me ha gustado mucho la verdad y la calidad de video es bastante aceptable!!! A ver ke os parece!! Un abrazo Fanny 😉

      • Talion

        A mi no me gustó mucho. Visualmente es impresionante (la he ido a ver al cine), pero tiene muy poca historia (casi nada). Diría es que es el equivalente “terrestre” de Gravity (mucha acción y un apartado visual y sonoro impresionante, pero la historia o argumento es casi un accesorio). Por otra parte el personaje de Mad está completamente disminuido, es más bien casi secundario (la protagonista clara es Furiosa). Creo que el mensaje medio feminista de la película es demasiado notorio (no tengo problema con el asunto de los géneros, pero es casi propaganda feminista a mi parecer).

        Como dije, visualmente es brutal, pero se queda en eso. De todos modos dudo que a la gente le aburra, yo soy fan de la trilogía original y me quedo con ella… 6.5/10

        • fanny

          Me refería a la gente que conozco en persona jajajajaja, lógicamente en un blog donde hay tantísima gente va a ver diversidad de opiniones fijo, a las secuelas o remakes se les suele exiger mucho o verlas con lupa a las anteriores.
          Un poco ya me conoceis por aquí ( hay muy pocas pelis de 10/10) pero si consigue entretenerme, tiene una visual impresionante como dices ya me conformo.
          Igual no me gusta como ti, no lo se, ésta noche la veré y opino.
          Un abrazo Talion y gracias por tu comentario ( como siempre a tener en cuenta)

          • Talion

            Ja ja claro, en realidad tu comentario me sirvió de excusa para pasar a opinar de la cinta. Igual no es que a mi no me parezca una buena cinta, de hecho la recomiendo, es solo que no me ha gustado tanto. Siento que está un poco sobrevaluada, pero es solo mi opinión 😛

            PD: Aprovecho de editar mi comentario original porque me parece recomendable la película, pero creo que no se entendió así 🙂

  • Tatiana Pereyra

    3 gb??? me va a demorar 1 semana en descargar jajaja

  • Alfredo Marin

    “El Futuro petenece a los locos”, de locos está también esta versión de 3Gb, jeje, el clásico de Gibson me trae recuerdos de mi infancia cuando la veía con mi viejo, ahora veremos si es cierto que no decepciona…sin comparar claro está…gracias amigo Mono, un abrazo

  • Es impresionante, os dejo lo que escribí ya en mi página del Caralibro, para no repetirme:

    Tenéis que ir corriendo a ver Mad Max: Furia en la carretera…
    Es de lo mejorcito que he visto en cuanto a aprovechamiento de una gran pantalla en el cine.

    Que se quiten hobbits, ultrones y demás fauna palomitera.

    Un diseño de producción impecable, la acción rodada al milimetro,
    personajes secundarios que dejan volar la imaginación, y en definitiva,
    una película que encumbra la saga.

    Además de todo eso, que ya me valdría, hace un analisis del patriarcado
    y el matriarcado, defendiendo la postura de este último frente a una
    sociedad sin normas, priorizando los valores del cuidado frente a los de
    la ley del más fuerte, siendo los personajes femeninos los
    protagonistas de esta cinta.

    Así que como comentaban por ahí, si
    que es una película que plantea ciertos mensajes feministas, (como el de
    que el patriarcado solo ve a la mujer como madre o reproductora), o que
    la fuerza de todas las mujeres juntas es capaz de vencer a un macho

    Si bien, creo que no es la intención de la cinta que es más
    bien el entretenimiento, si que creo que hay que llamar a cada cosa por
    su nombre.

    Así que ya sabéis, id corriendo al cine, sed testigos.
    Será un dinero muy bien empleado, os lo prometo.

  • Y además estaba deseando verla en VO. Que ya la he visto en español latino y en español, y quiero oir las voces de Max, Furiosa e Inmortal Joe en su interpretación.

    En fin, a mi me parece lo mejor que he visto en el cine en muuuuuuuuuuuuuuuucho tiempo.
    Si bien hay gente que se queja del guión, que la revisite y vea toooooodo lo que sugiere del mundo que ha perfilado Miller (y que copió la saga Fall Out, entre otros muchos).

    A mi entender es más lo que sugiere que lo que cuenta. Y en su defensa, diré que Mad Max 2, que hasta el momento suele ser la favorita de todo el mundo, Mel Gibson solo habla en 12 ocasiones en toda la película.
    Y sigue siendo un clásicazo.

    • Talion

      A mi entender se sugiere, pero no mucho. Es casi todo bien evidente y los personajes en muchas ocasiones me parecen muy unidimensionales. No creo que sea cosa de la cantidad de diálogos (que como bien dices la segunda casi no tiene diálogos Max). A mi me parece una buena película, pero creo que se orienta mucho por el lado del ritmo y el apartado visual y deja el guión como accesorio.

      PD: Aun así, insisto, visualmente es brutal… Como para verla más de una vez.

      Saludos Sr. Plastiko.

  • DAVO

    Yo la vi en el cine y me pareció espectacular!!

    Muchas gracias!!! A ver que tal se ve… 😉

  • mutter1978

    Me corto los diez dedos y se los ofrezco de calificación a este film, hacia muchos años que no pisaba una sala de cine y de buenas a primera está peli me llama cual miel a las abejas, no he salido más que feliz al ver que el cine como tal no ha muerto y que todavía se pueden hacer obras como esta. Adelante caballeros que si no la miran se van a peder de algo Fenomenal.

  • profondorosso

    Qué descohone con los de sed testigos y el jodio Immortal Joe que repite haciendo de malo.

  • pablo

    Mono querido!! como siempre gracias por las peliculas!! aproposito te nes alguna novedad acerca de EXORCISMO DOCUMENTADO?? estoy esperando con muchas ganas de verla, se sabe algo?? te dejo el link de mi nueva banda MAGICO QUIMICO para que nos conozcan, abrazo de rock!!

  • gatodelbien

    No intento hacer menos a Mono y el trabajo que realiza, pero de ser posible véanla en el cine y en imax, es de lo mejorcito que he visto en el cine de acción de los últimos años

  • Bajando … =]

  • faridsaid

    Yo la queria ver en el cine, pero no soporto ver las peliculas traducidas y en México en muy pocas salas se proyecta en idioma original. Gracias Mono como siempre.


    1000 veces prefiero ver peliculas en mi habitación… que ir al cine y estar rodeado de niños ratas gritando y haciendo ruido con sus papas fritas y pochoclos…. muy buena pelicula gracias mono… solo falta insidius si sale para mi cumpleaños (3 de junio) te levanto un monumento de oro mono :D!!!

  • Jason Voorhees

    gente como se ve esta versión que calidad de imagen? gracias

    • fanny

      Hola Señor del machete……
      Bueno se ve, es una TS- alta calidad ….. pero conociéndote un poco y por tus comentarios esperaría a una versión y un audio mejor, creo que la peli se lo merece por los comentarios tan buenos que tiene.
      PD: Como siempre al gusto del consumidor
      Un abrazo Jason

      • Jason Voorhees

        Pues si, si que me conoces jeje
        tocara esperar un tiempito mas, otra que estoy esperando a una mejor calidad es la segunda parte de divergente.
        muchas gracias fanny abrazo!


      Jason Voorhees yo la estoy viendo y asi se ve.. te dejo unas capturas de pantalla… saludos

      • Jason Voorhees

        muchas gracias por tomarte la molestia de las capturas y todo!
        personalmente prefiero esperar un poco mas, este tipo de peliculas me gusta verlas en muy buena calidad si es posible en hd o full. gracias de nuevo!

      • fanny

        No sé de donde eres, lo digo por el horario….
        Aquí son las 00.01 con lo cuál 3 de junio.
        Desearte un FELIZ CUMPLEAÑOS y que tengas un bonito día.
        Un saludo
        PD: Siento que no esté Insidious 3 para hoy……


          muchas gracias fanny.. no importa si no esta aún insidius3.. ya que 3 de junio tengo mi primer parcial de informatica asi que me encuentro estudiando para ir a un examen en pleno dia de mi cumpleaños ¿que regalito no? asi son las cosas jajaja.. soy de argentina 😀 saludos para vos tambien!!!

  • ajopedo

    Esta película es una patada en las pelotas de proporciones bíblicas! Impresionante, como hacer un peliculon sin necesidad de contar ninguna historia….ni le falta ni le sobra absolutamente nada…

  • DAC65

    Buena la película, te entretiene y mucho, tenia que ser el mismo director para no defraudar al espectador, la vi en el cine y si vale la pena pagar por ella. saludos.

  • Ada González

    Esta película es tremenda, George Miller excelente dirección, la vi en el cine y de verdad te involucras de tal manera en la trama que llegas a sentir euforia; es un viaje de locura y violencia perfectamente plasmado en la pantalla. Charlize Theron opacó en muchas oportunidades al propio “Max”, me encantó su personaje, definitivamente icónico. Le daría un 9/10

  • demonofthefallnet .

    Descargando pensando en que esta pelicula no se llama Mad Max sino que es la excusa para ponerla en contexto y con eso en la mente disfrutarla por lo que trae, gracias mono

  • faridsaid

    Mono, muchas gracias por la peli. Aun es de cine, esperare a una mejor versión.

  • (Of Thorns)

    Maravillosa, recomiendo que la vean antes en cines que descargarla y verla en casa.

  • Cosas que hago cuando tengo un rato libre… Homenajear sagas que me molan, entre otras cosas…

    Espero que les guste.

    • Jose Hernandez

      Eres muy bueno 😀

      • Gracias Jose, siempre me ha gustado dibujar desde que era un renacuajo.

        • fanny

          MUYYYYYY BUENOOOOO!!!!!!
          Un abrazo Sr.Plastiko

        • JMarple


    • (Of Thorns)

      Genial la ilustración, me ha encantado. Mi novia también está haciendo algunas de Imperator Furiosa y Immortan Joe, la película es 100% inspiradora ^^

      • JMarple

        cuanto talento en los usarios y en las novias de los usuarios! me encantaron!

        • fanny

          Hay mucho talento aquí en los usuarios-novias sin duda ( y el que no se ha mostrado aún).
          PD:Yo me quedé sin él desde mi mezcla de cables ( antes distinguía una escocesa de una francesa) y mira ahora….debo dormir más, porque para quitarme sueño por el maratón de éste fin….mejor dormir.
          Un abrazo reina, menos mal que andas por aquí para ponerme los cables en su sitio.

          • JMarple

            jajaja duerme cual angelita entonces.
            Ah y es verdad…se dice cruzar los cables, lo de mezcar se ve que lo inventé yo.

        • Gracias [email protected], ando ahora con uno de The Warriors, que también tenía ganas de hacerlo desde hace tiempo.

      • Muy buena mano con las tramas tu chica. La verdad que el mundo que presenta la película da para mil ideas (y franquicias)

        • (Of Thorns)

          Gracias por apreciarlo. Cierto, no por nada esta franquicia ha inspirado cómics, videojuegos y por supuesto muchas películas: El Puño de la Estrella del Norte, Borderlands o Stryker respectivamente son solo unos pocos ejemplos.

          • Y no olvidemos Fall Out

          • Creo que el Fall Out 1 y 2,(y el Tactics), fueron los juegos que me tuvieron despierto hasta más tarde. XD

          • (Of Thorns)

            Cierto, el perro de Fallout es solo uno de los muchos guiños a Mad Max.

  • Asty

    ésta película por sí sola deja en ridículo a la mayor parte de películas de acción de la última década, y hace que la saga entera de rápidos y furiosos parezca una telenovela colombiana.

  • Se deja ver, aunque hay alguna parte poco nítida.
    Eso si, si puedes ver a verla al cine, que la experiencia en pantalla grande lo merece.

  • Pris Paola Andrade

    No mamen, se ve bien oscura, esta grabada del cine o que?

  • flopez

    Aviso para quienes todavia no han visto la peli que ya hay version Web-dl en 720p y 1080p (evo y rarbg.


    Sr. Administrador MonoHB aqui le dejo una version en 720p con subtitulos en español en descarga directa para que la revise a ver que le parece!nolnBSrC!AEUSvwBZNaDAKlcrj_YZhgA4ojMAcVMGwBhOSI98Vn0


  • Tatiana Pereyra

    Estas pelis son ideales para verlas en pantalla grande, calidad HD, muy buena. La historia no es para matarse y de hecho no me gusto la interpretación del actor que hizo de MAX, me quedo mil veces con Mel Gibson aparte me pareció que tenia muy poco dialogo y la personalidad no estaba bien captada, este era muy serio y Mel era mas gracioso. Prácticamente la protagonista de toda la peli es Charlize Theron, Max se me quedo atrás jajaj. Igual super recomendable por los efectos.

  • Jason Voorhees

    la saga original tampoco es la gran cosa, la 1 y la 2 son buenas aunque muy diferentes, casi podrian ser de otra saga… pero la tercera parte es un chiste

  • Jason Voorhees

    Mono ya hay por la red versiones de buena calidad de esta peli! saludos

    • MonoBH

      Ya esta publicada, en calidad HD.

  • Nyctophilia

    yo me la quería ver en cine la verdad, pero como está la situa pues se agradece postearla acá, así que bajando.

  • Pablo L

    Peliculon! son dos horas de accion que no te deja respirar, efectos excelentes y no tiene partes aburridas ni desperdicio.
    Muy recomendable para los amantes de la accion mi nota un 8.5/10.

  • El Gato Patagonico

    Los cines de Bariloche son bastante Poronga, las sacaron a los pocos dias…, y me la perdi, la descargue de aca, ..y la puta!…. que bueno que la siguio el mismo director, no pierde la esencia,una de las mejores de lo que va en el año. 9/10

  • Saso Sitya

    aca en uruguay tambien la sacaron al toque una pena, hubiera querido verla tbien. ahroa la voy a descargar mas tarde publico a ver que me parecio.

  • Jason Voorhees

    Una locura esta pelicula! y recien caigo que es el mismo director que las primeras 2!
    desde el primer minuto te tiene pendiente no deja respiro, super bien logrado el mundo mad max desde los lugares hasta la gente todo perfecto, si no es la mejor peli del año pega en el palo

    • GoodMilo

      Será la trilogía completa, George Miller dirigió,guionizó y produjo las 3 de Mad Max con Mel Gibson y le ha echado pelotas para volver a hacer lo mismo con esta entrega y tengo entendido que hará otra más,este señor tiene todos mis respetos,eso es hacer buen cine y que aprendan los demás 😉

  • José Javier Moratón Soler

    Puro espectáculo…perfecta en su realización y en su producción..lo único que no me termina de convencer es el Loco Max, su reencarnación no da la talla, en mi humilde opinión..Charlice perfecta, incluso manca, desaliñada y sucia…otra cosa que no me convence, por sacarle algún defecto, es el protagonismo de las “madres”…un saludo

  • Saso Sitya

    La verdad tremenda pelicula, hacia tiempo que no veia tanta accion y adrenalina compactada en 2 horas, no hay momento de respiro salvo cerca del final cuando aparecen las motoqueras.
    Concuerdo en que el madmax queda medio intrascendente en el papel, pero la verdad tampoco estuvo mal. totalmente recomendada.


    La critica para cuando ??


    La critica para cuando ??

  • Deyan Atfield

    Buenas noches bloghorreros hoy le toco el turno a la película mas comentada de este año, empezaré por decir que la ambientación, fotografía, sonido y actuaciones (excluido Max) fueron exquisitas, si eres un amante de la acción a chorros esta es tu película, pero que decir del lado argumental, ami parecer es su talón de Aquiles al parecer tomaron mad max 2 y 3 y las mezclaron de manera magistral pero si piensas hacer una trilogía creo q hubiera sido mejor hacerlas 1 x 1 ir por partes no echar todos los huevos en una sola canasta todos los que hemos visto el clásico mad max con mel sabemos q. El remake no debió empezar asi, bueno quizá sea solo sean cosas mías Mono gracias por darnos el entretenimiento saludos bloghorreros un fuerte abrazo a todos

  • Pacobreak

    MAGISTRAL en todo!!!!!. No voy a decir nada más sobre esta impresionante producción ya que [email protected] coincidimos en que es una obra maestra.
    Matizar, que el personaje Max es el correcto a mi modo de ver. En la segunda y tercera parte, Max no es un hombre sociable y menos conversador. No se porqué no os llega a gustar este Max….es el mismo personaje. Parco en palabras, intratable e insosiable (a veces).
    10/10……Obra maestra!!!!!!

    • fanny

      La única obra maestra es la nuestra!!!!! Aflojemos….
      Un abrazo

      • Pacobreak


  • fanny

    Espléndida !!!!!!! 9/10
    Una excelente película para pasar un gran rato, no tiene desperdicio…….

    • Dra. Gari

      Qué bien que leo esto, Fanny! Vine a bajarla porque se la tengo prometida a mi papá para el fin de semana y me alegra saber que la pasaré bien (por tu crítica y la de “la opinión pública”).

      Saludos y no estamos leyendo!

      • fanny

        Un buen rato entretenido seguro que lo vais a pasar ( o eso creo), ahora si, después puede ocurrir que no os guste jajajajajjaja, yo me lavo las manos.
        Un abrazo Dra.Gari

        • Dra. Gari

          Aleja la alegoría cristiana, Fanny. La película es genial! Mi papá y yo disfutamos de lo lindo.

          • fanny

            Me alegro mogollón.
            Un abrazo Dra. Gari

    • San

      Holaaa! consulta, hace falta ver las anteriores, si es que las hay? o se entiende,,,

      • fanny

        La puedes ver, pero si tienes oportunidad mira las otras, por lo menos la primera.
        Un abrazo San

        • San

          voy a verlas entonces! gracias Fanny! beso

    • Lagarto Negro

      ¿Solo 9? fanny al menos dime porque le restaste un punto, porque no veo el negativo.

      • fanny

        Porque no me mola Theron rapada jajajajajajajjajaja.
        La peli es muy buena sin duda………………
        Un abrazo Lagarto

        • Lagarto Negro

          jajajajajajajajajajaja por eso me caes tan bien, a veces sales con un sentido del humor absurdamente negro pero simpatico, solo a ti te puedo perdonar quitarle un punto a esta película por eso jejeje

          • fanny

            Gracias por tu comprensión pero te debo un punto ya te lo meteré por otro lado.
            Un abrazo Lagarto

  • Jesús Fcb Rodríguez

    10/10 hasta la fecha la mejor película del año, la vi con cierto escepticismo ya que los remakes tienen muy mala fama hoy en día, Banda Sonora exquisita y magistral, si ya la Saga era legendaria en la cultura popular, ésta película refuerza más ese concepto. Hay que verla no hay nada más que agregar.

  • vegafox

    Uffff! La acabo de ver,,,,Ciertamente es de lo mejor que ha salido en mucho tiempo y me refiero a años…Gracias Mono muy buena calidad de película…

    • Vegafox, vi que habías subtitulado algunas de la saga Buppah Rathree, y ando buscando un link o enlace para poder acceder a la versión de Asister de la parte 3.1, pk los subtitulos ya los tengo pero el video lo tengo de otro tipo.

      Estuve buscando la versión de la página, pero no tengo el link y el torrent al que linkea de esa versión es de una página privada que no aceptan nuevos miembros sin invitación. No tendrás tú un link para bajarla?

      Perdona las molestias company, si sabes algo avisame porfa.

      PD: Genial trabajo con la traducción del tailandés.

  • Lagarto Negro

    Simplemente espectacular:

    – Las actuaciones a pesar de no tener mucho dialecto (Pues realmente no lo necesita) fueron excepcionales, realmente increíble todo el trabajo en el reparto, desde los secundarios, los war boys, los protagonistas, TODOOO estuvo milimetricamente perfecto.
    – Los efectos especiales estuvieron simplemente apoteósicos, si no que dejando la esencia de la saga anterior crean al verdadero estilo MAX del siglo XXI acojonante.
    – Tengo que decir que no estoy muy de acuerdo con ambientaciones basadas en desiertos o zonas áridas muertas, pero entre tanta acción, sangre y explosiones no puedes hacerle caso a ese detalle, mas bien, no te llega a importar, esta película es ¡EXCELENTE! aun en ese aspecto.
    – La música es uffff algo asombroso e quedado anonadado con ese trabajo también, enserio no puedo creer pero que excelencia cinematográfica se acaba de crear caballeros.

    Bueno para finalizar tengo que decir que es la película de acción mas ¡BRUTAL! que e visto en mucho pero mucho tiempo, no solo continuaron de manera magistral la trilogía anterior si no que la mejoraron pero no hablo de una mejora ni siquiera de manera significativa cuadriplicaron en todos los aspectos todos los segmentos importantes de la misma creando a la vez un ejemplar de acción maravilloso. 11/10!!!!!!!!!!!!!!!!!!
    PD: Me sobro hasta un punto primera vez que me pasa eso criticando una película jajajajajajajajajaja xD

  • Luca Luca

    Habiendo visto las originales , que me han gustado muchisimo, tengo que decir que esta es una total porqueria para mi gusto, claro. Recordando el papel categórico de Mel Gibson, está claro que Tom Hardy no le llega ni a lols talones. La película se llama Mad Max,,claro, pero Mad Max parece ser un actor de reparto…que participa poco y nada en la película, no habla, no hace nada. Veo que a algunos les ha gustado muchisimo, y es respetable la opinión de cada uno..A mi me pareció pésima, aburridisima, efectos especiales muy indebles, muy malo el guión..en fin..Si son fans de la original, no la recomiendo de ninguna manera.

  • Bastante entretenida, aunque no adentran mucho en las historias de los personajes, me hubiera gustado conocer mas de ellos y coincido en que el papel de Max parecía un personaje secundario y no el principal.

    • Fhercho06

      Tienes toda la razón, tengo entendido que dejaron para una secuela la trama respecto a Max, es decir, la segunda entrega se centrará en él.

      • Ahh no sabia eso, entonces a esperar la secuela, saludos!!!

        • Fhercho06

          Eso sí, la secuela sería de aquí a unos tres o más años, ya que como mencionó el director George Miller, se encontraba cansado de tanta arena del desierto. jajaja Saludos..

  • Samael Fall

    Me encanto, de lo mejor visto en años.

  • joe

    Entretenida y muy bien realizada, no es GUUUUUUUUAAAAAAAAAUUUUUUUU es la típica peli para ver entre amigos, flashera al mango.

  • Hernán Andrés Már

    Espectacular y por algo gano como varios Oscars ,por que las escenas ,maquillaje ,escenas etcétera!

  • Gonzalo Ignacio

    en lo visual y acustico es realmente maravilosa, digna de verse en el cine o full hd en gran pantalla y home theatre. la historia en si es mediocre repetitiva, no es para nada buena como historia; pero vale la pena verla si se tienen las condiciones tecnologicas para hacerlo.

  • Fabi

    No entiendo como a la mayoria les gusta esta peli, y encima se llevo varios oscars, es aburrida, visualmente esta buena pero en si es muy aburrida loco, la verdad no entiendo

  • Dimas Baquero Lazcano

    Pelicula completamente sobrevalorada por sus efectos especiales.

  • Stormeye

    Muy buena pelicula. El argumento es muy sencillo, pero deja mensajes que hace que se compare con las anteriores entregas de una forma muy interesante dando una vision mas esperanzadora de ése mundo postapocalíptico. Las actuaciones, el trabajo en las escenas de accion y el vestuario son impecables. Aún así ha sido muy sobrevalorada en cuestion de nominarla a mejor pelicula, basta con comparar la profundidad de su argumento y evolucion de personajes con The Dark Knight que no recibio nominacion a ésta categoría siquiera y creo que todos sabemos de la subjetividad de los Oscar con respecto ciertas producciones. 8/10 Diría que nomás por la simplicidad del argumento y el enfoque en la acción hacen que no sea algo sublime.

  • pablo

    MAGICO QUIMICO ( powerdark ) desde la oscuridad